FLCN, folliculin, 201163
N. diseases: 160; N. variants: 127
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 17 | 17213815 | frameshift variant | -/T | ins | 8.0E-06; 3.6E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 17 | 17223929 | stop gained | GC/TA | mnv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 1 | 2010 | 2010 | ||||||||
|
1.000 | 0.080 | 17 | 17214999 | inframe deletion | CTT/- | del | 4.0E-06 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2011 | 2013 | ||||||
|
1.000 | 0.080 | 17 | 17226276 | frameshift variant | T/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2005 | 2008 | ||||||||
|
1.000 | 0.080 | 17 | 17228025 | frameshift variant | C/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 1 | 2005 | 2005 | ||||||||
|
1.000 | 0.080 | 17 | 17216461 | frameshift variant | T/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||
|
1.000 | 0.080 | 17 | 17227936 | frameshift variant | T/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17227899 | frameshift variant | T/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17224107 | frameshift variant | C/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17219148 | frameshift variant | AG/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17224087 | frameshift variant | C/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17222542 | frameshift variant | ACTT/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17221557 | frameshift variant | A/- | del |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
0.925 | 0.080 | 17 | 17216395 | frameshift variant | G/-;GG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 7 | 2002 | 2015 | ||||||||
|
1.000 | 0.080 | 17 | 17215237 | frameshift variant | GA/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2005 | 2017 | ||||||||
|
1.000 | 0.080 | 17 | 17216506 | splice region variant | GGA/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2010 | 2017 | ||||||||
|
0.925 | 0.080 | 17 | 17224069 | inframe deletion | AAG/- | delins | 4.0E-06 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2008 | 2017 | ||||||
|
1.000 | 0.080 | 17 | 17219188 | frameshift variant | TTCT/- | delins | 8.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 2008 | 2016 | |||||||
|
1.000 | 0.080 | 17 | 17215032 | frameshift variant | -/ACAG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 2005 | 2015 | ||||||||
|
0.925 | 0.080 | 17 | 17219126 | frameshift variant | -/GTACTCTCTGGCAACACAGGGGCTTTCT | delins | 4.0E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 3 | 2002 | 2016 | |||||||
|
1.000 | 0.080 | 17 | 17226224 | frameshift variant | -/T | delins | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 3 | 2008 | 2013 | |||||||
|
1.000 | 0.080 | 17 | 17215299 | frameshift variant | C/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2014 | 2018 | ||||||||
|
1.000 | 0.080 | 17 | 17226252 | frameshift variant | AC/GTG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2008 | 2011 | ||||||||
|
1.000 | 0.080 | 17 | 17216428 | frameshift variant | G/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2008 | 2014 | ||||||||
|
1.000 | 0.080 | 17 | 17223956 | frameshift variant | C/- | delins | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2005 | 2008 |